[SOLVED] Move lines in file using awk/sed

Issue

Hi my files look like:

>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA
>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA

and I want to move the lines so that line 1 swaps with 3, and line 2 swaps with 4.

>ID.2
GGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGA
>ID.1
GGAACACGACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAAAAGTACTGGA

I have thought about using cut so cut send the lines into other files, and then bring them all back in the desired order using paste, but is there a solution using awk/sed.

EDIT: The file always has 4 lines (2 fasta entrys), no more.

Solution

Using sed:

sed '1h;2H;1,2d;4G'

• Store the first line in the hold space;
• Add the second line to the hold space;
• Don't print the first two lines;
• Before printing the fourth line, append the hold space to it (i.e. append the 1st and 2nd line).

Answered By - choroba

Answer Checked By - Senaida (WPSolving Volunteer)